ID: 1107141065_1107141076

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1107141065 1107141076
Species Human (GRCh38) Human (GRCh38)
Location 13:36999175-36999197 13:36999222-36999244
Sequence CCGCAGTCTCCAGGAGAGCGGTA TCCCTGTTCTCACCAGTACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 97} {0: 1, 1: 0, 2: 1, 3: 11, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!