ID: 1107164718_1107164725

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1107164718 1107164725
Species Human (GRCh38) Human (GRCh38)
Location 13:37270940-37270962 13:37270983-37271005
Sequence CCTAGAATGTGAGGACAGCCCCT CCCCAGTGTCAATAGTGCTGTGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 48, 3: 231, 4: 694}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!