ID: 1107242107_1107242112 |
View in Genome Browser |
Spacer: -2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1107242107 | 1107242112 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 13:38248690-38248712 | 13:38248711-38248733 |
| Sequence | CCTTTCTCCTCCTCCTTCTTCTG | TGCTGTTCTGGCTCCATTTCAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 8, 2: 138, 3: 777, 4: 3677} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||