ID: 1107255473_1107255479

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1107255473 1107255479
Species Human (GRCh38) Human (GRCh38)
Location 13:38421040-38421062 13:38421090-38421112
Sequence CCTTATTTACTCCAAACTATGGA CTAGAAGAGTGAAGGCCTCCTGG
Strand - +
Off-target summary No data {0: 27, 1: 53, 2: 45, 3: 55, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!