ID: 1107475768_1107475775

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1107475768 1107475775
Species Human (GRCh38) Human (GRCh38)
Location 13:40734305-40734327 13:40734329-40734351
Sequence CCAACATAGAAGGGACAGAAGTC CAGGAGGAGGGCAAAATGATAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 147} {0: 2, 1: 0, 2: 4, 3: 18, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!