ID: 1107526956_1107526964

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1107526956 1107526964
Species Human (GRCh38) Human (GRCh38)
Location 13:41242436-41242458 13:41242482-41242504
Sequence CCCTGGTTCAAGAGAAAAATAGT CTAGGGTTGTCCACTACTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 292} {0: 1, 1: 0, 2: 1, 3: 6, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!