|
Left Crispr |
Right Crispr |
Crispr ID |
1107642097 |
1107642112 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:42454002-42454024
|
13:42454049-42454071
|
Sequence |
CCCTCCACCTCCTGGATTCAAGG |
GTAGCTGGGATTATAGGCACTGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 52, 1: 633, 2: 2069, 3: 3052, 4: 3209} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|