ID: 1107642097_1107642112

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1107642097 1107642112
Species Human (GRCh38) Human (GRCh38)
Location 13:42454002-42454024 13:42454049-42454071
Sequence CCCTCCACCTCCTGGATTCAAGG GTAGCTGGGATTATAGGCACTGG
Strand - +
Off-target summary No data {0: 52, 1: 633, 2: 2069, 3: 3052, 4: 3209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!