ID: 1107671467_1107671471

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1107671467 1107671471
Species Human (GRCh38) Human (GRCh38)
Location 13:42750491-42750513 13:42750506-42750528
Sequence CCTTCTTTTCATCAGCTTTGGTT CTTTGGTTCTTCAAGTGGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!