|
Left Crispr |
Right Crispr |
Crispr ID |
1107857940 |
1107857946 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:44633920-44633942
|
13:44633951-44633973
|
Sequence |
CCAAAAAACAGGGCCGGGCGCGG |
GCTTGTAATCCCAGCACTTTGGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 8256, 1: 229629, 2: 273895, 3: 182802, 4: 143013} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|