ID: 1107857940_1107857953

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1107857940 1107857953
Species Human (GRCh38) Human (GRCh38)
Location 13:44633920-44633942 13:44633967-44633989
Sequence CCAAAAAACAGGGCCGGGCGCGG CTTTGGGAGGCCGAGGCGGGTGG
Strand - +
Off-target summary No data {0: 39056, 1: 119917, 2: 190535, 3: 147315, 4: 99766}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!