ID: 1107908893_1107908899

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1107908893 1107908899
Species Human (GRCh38) Human (GRCh38)
Location 13:45086794-45086816 13:45086821-45086843
Sequence CCAAGTAAGGTCACATTCTGAGG GGGTAAATATGAATTTTGGAGGG
Strand - +
Off-target summary {0: 14, 1: 414, 2: 1008, 3: 1935, 4: 2987} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!