ID: 1108014547_1108014551

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1108014547 1108014551
Species Human (GRCh38) Human (GRCh38)
Location 13:46060819-46060841 13:46060850-46060872
Sequence CCATTAAGCAGTCATGTTAATTT ACTTCATCGTCTCAGCCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 254} {0: 1, 1: 0, 2: 0, 3: 17, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!