ID: 1108058082_1108058092

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1108058082 1108058092
Species Human (GRCh38) Human (GRCh38)
Location 13:46505140-46505162 13:46505193-46505215
Sequence CCCCAGGAGAAGGGTGCACCTTC TACACCGGTATGCTTGAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 135} {0: 1, 1: 0, 2: 3, 3: 2, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!