ID: 1108058084_1108058090

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1108058084 1108058090
Species Human (GRCh38) Human (GRCh38)
Location 13:46505142-46505164 13:46505178-46505200
Sequence CCAGGAGAAGGGTGCACCTTCCC AGCTGCGTGTTGCACTACACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 176} {0: 1, 1: 0, 2: 4, 3: 2, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!