ID: 1108272044_1108272048

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1108272044 1108272048
Species Human (GRCh38) Human (GRCh38)
Location 13:48771218-48771240 13:48771250-48771272
Sequence CCACAGAAAATCACATACCTGAA GCGAGAGGGCTCCCTCAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 31, 4: 322} {0: 1, 1: 0, 2: 0, 3: 11, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!