ID: 1108272049_1108272054

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1108272049 1108272054
Species Human (GRCh38) Human (GRCh38)
Location 13:48771261-48771283 13:48771280-48771302
Sequence CCCTCAGTGTGGCTGACCTGACT GACTTCCCTCCGGGCCCCACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 13, 4: 141} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!