ID: 1108272050_1108272064

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1108272050 1108272064
Species Human (GRCh38) Human (GRCh38)
Location 13:48771262-48771284 13:48771310-48771332
Sequence CCTCAGTGTGGCTGACCTGACTT CAACCCAGACCCTCCACCCAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 12, 4: 144} {0: 1, 1: 3, 2: 7, 3: 52, 4: 428}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!