|
Left Crispr |
Right Crispr |
| Crispr ID |
1108293549 |
1108293554 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:48988186-48988208
|
13:48988226-48988248
|
| Sequence |
CCCACACAGTAATAGTGGGAGAC |
CAGTATTAGATCAACGAGACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 68, 1: 1389, 2: 7267, 3: 3125, 4: 1593} |
{0: 1, 1: 4, 2: 5, 3: 15, 4: 43} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|