ID: 1108317698_1108317701

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1108317698 1108317701
Species Human (GRCh38) Human (GRCh38)
Location 13:49253877-49253899 13:49253904-49253926
Sequence CCTTATGCTAAAGGCCCTCACTG TTTCCAGAACAGAAGCAATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111} {0: 1, 1: 0, 2: 5, 3: 29, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!