ID: 1109029474_1109029475

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1109029474 1109029475
Species Human (GRCh38) Human (GRCh38)
Location 13:57174693-57174715 13:57174706-57174728
Sequence CCTGGAAGAAGTGGGATGCAACA GGATGCAACAAGTGTCAGTAAGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 0, 3: 16, 4: 187} {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!