ID: 1109213650_1109213659

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1109213650 1109213659
Species Human (GRCh38) Human (GRCh38)
Location 13:59563465-59563487 13:59563489-59563511
Sequence CCCTCACTCCTCTGGTCACCCTC CAATGGATCCCTGTGGTGCCAGG
Strand - +
Off-target summary No data {0: 21, 1: 67, 2: 116, 3: 137, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!