ID: 1109213650_1109213663 |
View in Genome Browser |
Spacer: 10 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1109213650 | 1109213663 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 13:59563465-59563487 | 13:59563498-59563520 |
Sequence | CCCTCACTCCTCTGGTCACCCTC | CCTGTGGTGCCAGGCAGGAATGG |
Strand | - | + |
Off-target summary | No data | {0: 137, 1: 146, 2: 97, 3: 112, 4: 610} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |