ID: 1109213650_1109213663

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1109213650 1109213663
Species Human (GRCh38) Human (GRCh38)
Location 13:59563465-59563487 13:59563498-59563520
Sequence CCCTCACTCCTCTGGTCACCCTC CCTGTGGTGCCAGGCAGGAATGG
Strand - +
Off-target summary No data {0: 137, 1: 146, 2: 97, 3: 112, 4: 610}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!