ID: 1109213650_1109213666

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1109213650 1109213666
Species Human (GRCh38) Human (GRCh38)
Location 13:59563465-59563487 13:59563508-59563530
Sequence CCCTCACTCCTCTGGTCACCCTC CAGGCAGGAATGGCCTCCTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 55, 2: 169, 3: 137, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!