ID: 1109538076_1109538078

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1109538076 1109538078
Species Human (GRCh38) Human (GRCh38)
Location 13:63741427-63741449 13:63741447-63741469
Sequence CCAGTGGGGAAGAGGGGCTGGCT GCTCTCAGTCCCTGCCTCGCGGG
Strand - +
Off-target summary No data {0: 28, 1: 91, 2: 111, 3: 102, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!