ID: 1109538076_1109538080

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1109538076 1109538080
Species Human (GRCh38) Human (GRCh38)
Location 13:63741427-63741449 13:63741449-63741471
Sequence CCAGTGGGGAAGAGGGGCTGGCT TCTCAGTCCCTGCCTCGCGGGGG
Strand - +
Off-target summary No data {0: 30, 1: 79, 2: 108, 3: 99, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!