ID: 1110094696_1110094700

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1110094696 1110094700
Species Human (GRCh38) Human (GRCh38)
Location 13:71502480-71502502 13:71502520-71502542
Sequence CCTTGTCGGAGCTGTTTAACCAT ATTGATGCATGCATTCTATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47} {0: 1, 1: 0, 2: 0, 3: 17, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!