ID: 1110124999_1110125004

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1110124999 1110125004
Species Human (GRCh38) Human (GRCh38)
Location 13:71931678-71931700 13:71931717-71931739
Sequence CCAGCCCTGGGGAACTGTGAGTC TTTATAAATTACCCAGTCTCAGG
Strand - +
Off-target summary {0: 5, 1: 251, 2: 3897, 3: 9101, 4: 8936} {0: 6401, 1: 13084, 2: 14111, 3: 11019, 4: 7181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!