ID: 1110375006_1110375013

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1110375006 1110375013
Species Human (GRCh38) Human (GRCh38)
Location 13:74783478-74783500 13:74783512-74783534
Sequence CCGAGCGTGGCGGCTCATACCTG CTTTGAAAGGCCAAGGTGGAAGG
Strand - +
Off-target summary No data {0: 6, 1: 208, 2: 3703, 3: 32368, 4: 89859}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!