ID: 1110434571_1110434576

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1110434571 1110434576
Species Human (GRCh38) Human (GRCh38)
Location 13:75464689-75464711 13:75464727-75464749
Sequence CCCTTGATCTTGCATTGGCACAA CTGGAACCACTGTATGTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 98} {0: 1, 1: 0, 2: 0, 3: 9, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!