ID: 1110636114_1110636121

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1110636114 1110636121
Species Human (GRCh38) Human (GRCh38)
Location 13:77768514-77768536 13:77768542-77768564
Sequence CCGCCTCCTCGAGCCCCTCTATA AACCGCATCCCGCTGCTAACAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 8, 3: 138, 4: 402} {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!