ID: 1110642451_1110642456

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1110642451 1110642456
Species Human (GRCh38) Human (GRCh38)
Location 13:77841358-77841380 13:77841397-77841419
Sequence CCAAACACTGCATGTTCTCACTC CAGTGAGAACACGTGGGCATAGG
Strand - +
Off-target summary {0: 4435, 1: 11380, 2: 17706, 3: 10546, 4: 8009} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!