ID: 1110756875_1110756882

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1110756875 1110756882
Species Human (GRCh38) Human (GRCh38)
Location 13:79185001-79185023 13:79185052-79185074
Sequence CCCAAAGTGCTGGGATTATAGGC CTTAAAAGCTAGTTGTAATGTGG
Strand - +
Off-target summary {0: 20277, 1: 245443, 2: 271371, 3: 174555, 4: 143969} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!