ID: 1110756876_1110756882

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1110756876 1110756882
Species Human (GRCh38) Human (GRCh38)
Location 13:79185002-79185024 13:79185052-79185074
Sequence CCAAAGTGCTGGGATTATAGGCG CTTAAAAGCTAGTTGTAATGTGG
Strand - +
Off-target summary {0: 9370, 1: 149078, 2: 285159, 3: 214832, 4: 149190} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!