ID: 1110871312_1110871317

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1110871312 1110871317
Species Human (GRCh38) Human (GRCh38)
Location 13:80455437-80455459 13:80455459-80455481
Sequence CCCAGCACAGCAGCAGGTGCCTG GTAAATCCCAGCTACTTGGGAGG
Strand - +
Off-target summary No data {0: 78, 1: 283, 2: 1966, 3: 61223, 4: 164445}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!