|
Left Crispr |
Right Crispr |
| Crispr ID |
1110871312 |
1110871318 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:80455437-80455459
|
13:80455462-80455484
|
| Sequence |
CCCAGCACAGCAGCAGGTGCCTG |
AATCCCAGCTACTTGGGAGGCGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 374, 1: 1004, 2: 1942, 3: 6302, 4: 6082} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|