ID: 1110871313_1110871318

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1110871313 1110871318
Species Human (GRCh38) Human (GRCh38)
Location 13:80455438-80455460 13:80455462-80455484
Sequence CCAGCACAGCAGCAGGTGCCTGT AATCCCAGCTACTTGGGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 538} {0: 374, 1: 1004, 2: 1942, 3: 6302, 4: 6082}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!