ID: 1110871313_1110871322

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1110871313 1110871322
Species Human (GRCh38) Human (GRCh38)
Location 13:80455438-80455460 13:80455469-80455491
Sequence CCAGCACAGCAGCAGGTGCCTGT GCTACTTGGGAGGCGGAGGCAGG
Strand - +
Off-target summary No data {0: 263, 1: 76944, 2: 179089, 3: 221980, 4: 322234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!