ID: 1110871313_1110871323

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1110871313 1110871323
Species Human (GRCh38) Human (GRCh38)
Location 13:80455438-80455460 13:80455487-80455509
Sequence CCAGCACAGCAGCAGGTGCCTGT GCAGGAGAATCGCTTGAACCCGG
Strand - +
Off-target summary No data {0: 41236, 1: 112059, 2: 146946, 3: 86404, 4: 46144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!