ID: 1110871313_1110871324

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1110871313 1110871324
Species Human (GRCh38) Human (GRCh38)
Location 13:80455438-80455460 13:80455488-80455510
Sequence CCAGCACAGCAGCAGGTGCCTGT CAGGAGAATCGCTTGAACCCGGG
Strand - +
Off-target summary No data {0: 41137, 1: 134699, 2: 211581, 3: 171799, 4: 128801}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!