ID: 1110871313_1110871325

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1110871313 1110871325
Species Human (GRCh38) Human (GRCh38)
Location 13:80455438-80455460 13:80455491-80455513
Sequence CCAGCACAGCAGCAGGTGCCTGT GAGAATCGCTTGAACCCGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 538} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!