ID: 1110871315_1110871322

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1110871315 1110871322
Species Human (GRCh38) Human (GRCh38)
Location 13:80455456-80455478 13:80455469-80455491
Sequence CCTGTAAATCCCAGCTACTTGGG GCTACTTGGGAGGCGGAGGCAGG
Strand - +
Off-target summary {0: 81, 1: 264, 2: 677, 3: 2333, 4: 4619} {0: 263, 1: 76944, 2: 179089, 3: 221980, 4: 322234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!