ID: 1110871315_1110871325

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1110871315 1110871325
Species Human (GRCh38) Human (GRCh38)
Location 13:80455456-80455478 13:80455491-80455513
Sequence CCTGTAAATCCCAGCTACTTGGG GAGAATCGCTTGAACCCGGGAGG
Strand - +
Off-target summary {0: 81, 1: 264, 2: 677, 3: 2333, 4: 4619} {0: 18679, 1: 97986, 2: 210130, 3: 185373, 4: 111476}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!