ID: 1110925763_1110925770

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1110925763 1110925770
Species Human (GRCh38) Human (GRCh38)
Location 13:81149537-81149559 13:81149574-81149596
Sequence CCTGCGCTGGGGTCTGGGGGGCA AGGATAGTTATTGGGAAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 49, 4: 396} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!