ID: 1111046478_1111046481

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1111046478 1111046481
Species Human (GRCh38) Human (GRCh38)
Location 13:82820467-82820489 13:82820483-82820505
Sequence CCAGCACAGTGGTTCCCTGCAAC CTGCAACCCTTTCTTGTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 135} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!