ID: 1111055074_1111055078

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1111055074 1111055078
Species Human (GRCh38) Human (GRCh38)
Location 13:82938438-82938460 13:82938470-82938492
Sequence CCTCTCTGGTTGTCTGCCTAACC TTGGATGCAAAACAAGAACATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 66, 4: 481}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!