ID: 1111221238_1111221242

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1111221238 1111221242
Species Human (GRCh38) Human (GRCh38)
Location 13:85207813-85207835 13:85207840-85207862
Sequence CCTAGAGACTTGTTGAATGATTT CAAAGTGCTGATAGTGATATGGG
Strand - +
Off-target summary {0: 29, 1: 513, 2: 2153, 3: 1968, 4: 1454} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!