ID: 1111302786_1111302788

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1111302786 1111302788
Species Human (GRCh38) Human (GRCh38)
Location 13:86366801-86366823 13:86366820-86366842
Sequence CCATGTTGGCAGCTGATTAGATG GATGGTATCCATCCAGATTGAGG
Strand - +
Off-target summary {0: 15, 1: 284, 2: 501, 3: 616, 4: 694} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!