ID: 1111536789_1111536801

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1111536789 1111536801
Species Human (GRCh38) Human (GRCh38)
Location 13:89612074-89612096 13:89612121-89612143
Sequence CCCTGCCGGATCCAGAGGGATGG CGGCAAACGGCAGTGGTGGACGG
Strand - +
Off-target summary {0: 12, 1: 63, 2: 139, 3: 135, 4: 201} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!