ID: 1111542629_1111542633

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1111542629 1111542633
Species Human (GRCh38) Human (GRCh38)
Location 13:89689047-89689069 13:89689066-89689088
Sequence CCTAGGCAACTCCTCGTGCTGGG TGGGCTAGGCTCAGAGCCAGAGG
Strand - +
Off-target summary No data {0: 2, 1: 21, 2: 102, 3: 240, 4: 676}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!