ID: 1111592460_1111592467

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1111592460 1111592467
Species Human (GRCh38) Human (GRCh38)
Location 13:90367834-90367856 13:90367877-90367899
Sequence CCTAGACTGAACCCTTGGTGTTT AGAGGATGAGGAAGAGGAAAAGG
Strand - +
Off-target summary {0: 4, 1: 41, 2: 100, 3: 216, 4: 367} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!